Vignette for Clonmapper library

If you used the Clonmapper library to barcode your cells, follow this vignette to use NextClone.

First thing first:

1. Copy the nextflow.config file on our github repository: https://github.com/phipsonlab/NextClone.
2. Set the directory/file path in the config file for the following parameters:
   1. publish_dir
   2. clone_barcodes_reference
   3. dnaseq_fastq_files for DNA-seq data or scrnaseq_bam_files for scRNA-seq data.

Read the documentations on the homepage, make sure you understand what each of the parameter in the nextclone.config file is for.

Finally read on.

For DNA-seq data

Make sure at least the following parameters are set in nextflow.config file.

mode = "DNAseq"
barcode_length = 20

If your clone barcode is not 20 bp, change barcode_length above to 20.

Then pull the github code in the main branch and run.

nextflow run phipsonlab/Nextclone -r main

For scRNA-seq data

Before running NextClone, make sure you run cellranger first, and copy out the possorted_genome_bam file in the outs folder.

Then make sure at least the following parameters are set in nextflow.config file.

mode = "scRNAseq"
barcode_length = 20
adapter_5prime_clonmapper = "ATCTTGTGGAAAGGACGAAACACCG"
adapter_3prime_clonmapper = "GTTTCAGAGCTATGCTGGAAACAGC"

If your clone barcode is not 20 bp, change barcode_length above to 20.

You almost definitely will also need to change the 5’ and 3’ adapter sequence for your clone barcodes. This is denoted by adapter_5prime_clonmapper and adapter_3prime_clonmapper parameter. This sequence is determined by whoever made your library, and you should ask them for the sequence. The default sequence in the nextflow.config file is unlikely to match the one that is in your ClonMapper library.

Then pull the github code in the main branch and run.

nextflow run phipsonlab/Nextclone -r main

back